Answer is : Growing Silkworms: Posted by MC at 7:40 PM. Question 9. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. New questions in Art. Mention it's characteristics? a. 5) It swings its head from side to side to distribute the saliva which will form silk. Share 6. Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. Sericulture is also known as silk farming. Answer . Rearing of silkworm to produce raw silk is called sericulture. Explore the MCQs for chapter 16 Management of Natural Resources. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. 0 rearing of silk. What is horticulture? Question 15. Define sericulture. C. Both of the above. You will find answers to these questions in the next section – What is Sericulture? Answer. …. Question 8. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. Sericulture is also known as silk farming. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . Without the organelle that does this, the animal Explanation: not under stand search in google. Answer: Sorting is the process of separating the different textures of hair. Courtesy : wikipedia balanced equation and give evidence Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Regards. These are two types of silk worm reared in Nepal, i.e. What is called reeling the silk? Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. The arrow labeled C represents a transfer of chemi Show more Q&A. question_answer. Which are the important plantation crops in India? The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. … 1.Force Thank you​. Using the diagram above, answer the following questions: Both the statements are correct statements. Want to see this answer and more? Silk was believed to have first been produced in China as early as the Neolithic Period. Question 2. (a) 75% (b) 85% (c) 65% (d) 50%. Rearing: The bringing up and looking after the sheep is called rearing. Which fibre is the expensive fibre? (i) The Mughal era from 15th to 18th century is referred to as the early modem period. Category : General Knowledge: Question 928: What is sericulture?. Answer. Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. Upvote(0) How satisfied are you with the answer? Why do we need clothes? The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, 8. Explain chromosomes. * See Answer *Response times vary by subject and question complexity. Question 8. Tagged in. We use silk to make clothes and apparels. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. True or False. A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. Question 24. Rearing of silk worms for obtaining silk is called sericulture. Which country is the leading producer of wool? AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Answer. Physics. Question 1. cell won't be able to Answer: (b) Mexico. Sericulture is a cottage industry. Question 6. But have you ever wondered where silk came from? 9) The silk filaments are then wound on a reel . Recommend (0) Comment (0) person. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. One coccon contains approximately 1000 yards of silk filaments. Sericulture is the process of raising silkworms for their silk. The rearing of silkworms for the production of raw silk is known as sericulture. What is sericulture? Silk worms are beneficial and useful insects. for your conclusion. 7. Sericulture is rearing of silkworms for production of silk. (a) North East India (b) Mexico (c) Brazil (d) Malaysia. Answer these questions. Answer: Coconut 2. 1)The silk moth lays thousands of eggs. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. Wiki User Answered . …, equence. 6) The silk solidifies when it comes in contact with air. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Sericulture is the process of cultivating silkworms and extracting silk from them. A uneven twill B. Sericulture C. dying D. Ikat-technique 11. If you need more info, try doing a search on sericulture. NCERT RD Sharma Cengage KC Sinha. Which organelle is this . Newer Post Older Post Home. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? Answer. Given below is a sequence of steps in the processing of wool. Answer… The arrow labeled A represents a transfer of solar energy to chemical energy. The cultivation of crops is done for personal consumption. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples This is cruelty against insects. Wiki User Answered . They are reared in Sericulture. This process is called shearing. No comments: Post a Comment. …. Biology . 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Silk was believed to have first been produced in China as early as the Neolithic Period. Sericulture is a process of rearing of silkworm to obtain silk. toppr. Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. Ask your question. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. • Bombyx mori is the most widely used species of silkworm and intensively studied. What is sericulture? 9. Question 7. These eggs hatch into caterpillar or larvae. Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. In commercial cultivation, the mulberry garden is generally established through stem cuttings. Answer: Australia. (a) Barter system (b) Water system (c) Farm system (d) All of these. Sericulture is the process of cultivating silkworms and extracting silk from them. What are the problems of Indian agriculture? Exhaustive questions with answers are provided. Answer. It is the rearing of silkworms to obtain silk. Top Answer. Still have questions? Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. The stages of silk production are as follows. 1 Answer. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Sericulture is the raising of silk worms. What process is occurring at the arrow(s) It involves low levels of technology and household labour to produce a small output. Maths. Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Question 7. Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. 1 ; MULBERY CULTIVATION. The best one gets 25 in all. True or False. This is from wikipedia, I hope it helps. b. It is also known as shifting cultivation. 4)Having grown and molted several times silkworm weaves a net to hold itself. Sericulture is the production of silk and the rearing of silkworms for this purpose. Get 5 credit points for each correct answer. Question 25. Sericulture is the process of rearing of silk worm for obtaining silk. Labels: General Knowledge. divide and will die. 0 ; Silk fibres are valso animal fibres. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. The rearing of silkworms for obtaining silk is called sericulture. When the packaging warehouse of the cell is done with the proteins, it loads them into It may supplement the income of the farmer. Sericulture is the process of cultivating silkworms and extracting silk from them. Answer. Ans: the lultivation of silk worm is called sericulture. What fabric is found in Vietnam? Gaurav Teharpuria. …, 27. Share to Twitter Share to Facebook Share to Pinterest. You may refer to the answer provided by your friends @Others..Good work..keep posting! add. Silkworms spin the ' silk fibres'. Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Root wilt and Bud rot are the major diseases of? Silkworms are used to produce silk. But the art of sericulture was held by … 0 votes . Sericulture, floriculture, moriculture, apiculture and silviculture. Share with your friends. toppr. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Find 4 Answers & Solutions for the question What is sericulture? Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. View Full Answer rearing of silkworms is known as sericulture. The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. 2 ; … your answer. Kumar adityadev. • Stages of production of silk • The silk moth lays eggs. Question 14. Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). Download PDF for offline reading FREE only at BYJU’S. Describe the process or processes you selected. Silk firer is obtained from silk worms in sericulture. Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. The study of silkworms is called Sericulture. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels Explain MEDIUM. Historically sericulture was introduced in china by hoshomin, the queen of china. • The eggs hatch, and the larvae feed on mulberry leaves. Chemistry. Upvote(0) How satisfied are you with the answer? Find more answers . ask related question comment. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Paragraph on Sericulture! Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. Answer: (a) Sericulture. ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. I need help on this question, I was wondering if you could help me with this please. Find more answers. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. What is meant by rain shadow area? wHAT IS SERICULTURE. NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. Ask your question. Explain why this is true or false. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. Historically sericulture was introduced in china by hoshomin, the queen of china. II. Sericulture is rearing of silkworms for production of silk. you selected? It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. cal energy to mechanical energy. Answer: (d) sericulture. The stages of silk production are as follows. (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. 2.Motion A student proposed that the balanced chemical equation for this reaction is: Fibre to Fabric Class 6 Extra Questions Short Answer Type. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! Answer: It is known as Jhumming’ in the north-eastern region of India. 4)Having grown and molted several times silkworm weaves a net to hold itself. What are th NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. Answer. Still have questions? What is sericulture?. 10. 1 Thank You. Top Answer. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. It is a very old occupation in India. It is a very old occupation in India. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … Give an example and state the mount... Why most of the south indian rivers flow east ? Question 8. Question 3. 6. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Answer: (d) 50%. What is sericulture ? Get copy of last few answers in your mail. Recommend (0) Comment (0) person. Sericulture is also known as silk farming. 0 ; it is the rearing of silk worms for commercial purposes. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. The stages of silk production are as follows. Question 5. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. D. None of the above. It is the rearing of silkworms to obtain silk. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. India Climate Vegetation and Wildlife. Shifting cultivation is also known as Milpa in which part of the world. The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. Sericulture is an agro-based industry. Question 1. They develop by eating leaves of this plant. Answer. Answer: Silk. Answered By . Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. About 2500 silkworms are required to produce one pound of raw silk. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … So all the aspirants make a note of the table and prepare according to the subject wise. Answer: Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. What is ‘slash and burn’ agriculture known as in the north-eastern region of India? Email This BlogThis! Top Answer. Define Sericulture. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. What kind of silk worms are reared in Nepal? Wiki User Answered . Find answers to questions asked by student like you. Sericulture. Median response time is 34 minutes and may be longer for new subjects. Eri-silkworm and seri-silkworm, etc. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? What is called reeling the silk? General Knowledge Questions and Answers about Agriculture 1. …. …, When an animal cell is ready to divide, it begins to make long fibers that attach to the 2014-06-11 21:45:12 2014-06-11 21:45:12. Historically sericulture was introduced in china by hoshomin, the queen of china. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * What does gyrase do during DNA replication? The rearing of silkworms for obtaining silk is called sericulture. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Other types of silkworms (such as Eri, Muga, and … Answer: The rearing of silk moths for the production of silk is called sericulture. 2015-08-01 13:52:09 2015-08-01 13:52:09 . Sericulture; Answer: 1. What per cent of persons are engaged in agricultural activity in the world? Question 4. What is sorting? Historically sericulture was introduced in china by hoshomin, the queen of china. Ask & Answer; School Talk; Login; GET APP; Login Create Account. 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. Answer. Define sericulture. Answer: The rearing of silkworms for obtaining silk is called as sericulture. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. Hence sericulture or silk production is dependent on moriculture. ANSWER. Books. What is sericulture? (iii) Arab Muslims had been trading in the ports of the west coast. (ii) Muslim rule was established in Delhi at the end of the 12th century. The rearing of silkworms for the production of raw silk is known as sericulture. Sericulture is the process of raising silkworms for their silk. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. Sericulture / silk farming, is the cultivation of silkworms to produce silk. tiny bubbles to deliver them where they need to go. What is sericulture? In simple terms, it is the cultivation of silkworms to produce silk. Question 3. Describe the structure of a silkworm with a diagram. 1)The silk moth lays thousands of eggs . Sericulture is the whole process of obtaining silk starting from silk moth. The important inputs like seeds, fertilisers, machinery etc form a system called as? Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Answer: (b) Viticulture. answered by Lifeeasy Authors. 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Sericulture is the process of cultivating silkworms and extracting silk from them. why this is true or false. Answered By . 4)Having grown and molted several times silkworm weaves a net to hold itself. NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. 2015-08-01 13:52:09 2015-08-01 13:52:09 . Find out the correct statement. This practice has existed for a very long time. Answer. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. Determine whether this is a correctly chain, identifying the codons, anticodons, and amino acid s Sericulture is the cultivation of silk worms on a large scale for the production of silk. 3. Sericulture is the whole process of obtaining silk starting from silk moth. In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. Related Biology Q&A. You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide Elaborate on planning region? Sericulture, or silk farming, is the cultivation of silkworms to produce silk.